Stem-loop sequence dan-mir-133

AccessionMI0009005 (change log)
DescriptionDrosophila ananassae miR-133 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   ug    -     a             cauc  gu     -  auc 
5'   caac gcugu uguagcugguuga    gg  cagau cu   u
     |||| ||||| |||||||||||||    ||  ||||| ||   u
3'   guug ugacg augucgaccaacu    cc  guuua ga   u
   ua    g     -             -ucc  ug     c  acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12916: 7117525-7117613 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-133
dan-mir-133scaffold_12916: 7117525-7117613 [+]
dan-mir-288scaffold_12916: 7118748-7118839 [-]
Database links

Mature sequence dan-miR-133

Accession MIMAT0008468
Sequence

55 - 

uugguccccuucaaccagcugu

 - 76

Get sequence
Evidence by similarity; MI0000362

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).