Stem-loop sequence dan-mir-289

AccessionMI0009003 (change log)
DescriptionDrosophila ananassae miR-289 stem-loop
Gene family MIPF0000222; mir-289
Stem-loop
   gaguuuacaguaaaauaaauauuuaaguggagccugcgacucugcuacugccacugccacugccac     - ugc        ga 
5'                                                                   ugcca c   cgcucggg  g
                                                                     ||||| |   ||||||||   
3'                                                                   acggu g   gcgaguuc  u
   --------------------------------------------------------cagaaaaugc     u uuu        ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 21827586-21827702 [-]
intergenic
Database links

Mature sequence dan-miR-289

Accession MIMAT0008466
Sequence

16 - 

uaaauauuuaaguggagccugcgacu

 - 41

Get sequence
Evidence by similarity; MI0000385

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).