Stem-loop sequence dan-mir-33

AccessionMI0008998 (change log)
DescriptionDrosophila ananassae miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   cg      u    c  -g           c c        uccca 
5'   gagaug cacg ag  ugcauuguagu g auugucug     c
     |||||| |||| ||  ||||||||||| | ||||||||      
3'   cuuuac gugu uc  acgugacguca c uaacggac     u
   ca      -    c  ga           a a        cucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 19456798-19456887 [-]
intergenic
Database links

Mature sequence dan-miR-33

Accession MIMAT0008461
Sequence

15 - 

aggugcauuguagucgcauug

 - 35

Get sequence
Evidence by similarity; MI0000364

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).