Stem-loop sequence dan-mir-315

AccessionMI0008996 (change log)
DescriptionDrosophila ananassae miR-315 stem-loop
Gene family MIPF0000141; mir-315
Stem-loop
          auaa   ug          a       cuua   a 
5' cacuuau    uuu  auuguugcuc gaaagcc    uaa u
   |||||||    |||  |||||||||| |||||||    |||  
3' gugaaua    aaa  uaauaacgag cuuucgg    auu u
          aacc   gu          -       -ucg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 18585484-18585567 [-]
intergenic
Database links

Mature sequence dan-miR-315

Accession MIMAT0008459
Sequence

12 - 

uuuugauuguugcucagaaagc

 - 33

Get sequence
Evidence by similarity; MI0000427

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).