Stem-loop sequence dan-mir-279

AccessionMI0008991 (change log)
DescriptionDrosophila ananassae miR-279 stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   -u         u          a     c  uguu     uug  u 
5'   acuacuguu uuagugggug ggguc ag    ucaca   au u
     ||||||||| |||||||||| ||||| ||    |||||   ||  
3'   ugauggcaa aauuacucac ccuag uc    agugu   ug c
   cu         u          a     a  ----     uua  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 14200311-14200399 [-]
intergenic
Database links

Mature sequence dan-miR-279

Accession MIMAT0008454
Sequence

56 - 

ugacuagauccacacucauuaa

 - 77

Get sequence
Evidence by similarity; MI0000363

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).