Stem-loop sequence dan-mir-309

AccessionMI0008990 (change log)
DescriptionDrosophila ananassae miR-309 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
         c       c   uu    u    caau 
5' auuaua gacaaac uug  cggu uugc    u
   |||||| ||||||| |||  |||| ||||     
3' uaauau cuguuug aau  guca gacg    u
         c       a   gg    c    aucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 9731113-9731180 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-309
dan-mir-309scaffold_13266: 9731113-9731180 [+]
dan-mir-3scaffold_13266: 9731226-9731298 [+]
dan-mir-286scaffold_13266: 9731359-9731461 [+]
dan-mir-4scaffold_13266: 9731523-9731603 [+]
dan-mir-5scaffold_13266: 9731682-9731748 [+]
dan-mir-6-1scaffold_13266: 9731820-9731887 [+]
dan-mir-6-2scaffold_13266: 9731963-9732046 [+]
dan-mir-6-3scaffold_13266: 9732122-9732197 [+]
Database links

Mature sequence dan-miR-309

Accession MIMAT0008453
Sequence

43 - 

gcacuggguaaaguuuguccua

 - 64

Get sequence
Evidence by similarity; MI0000421

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).