Stem-loop sequence dan-mir-317

AccessionMI0008988 (change log)
DescriptionDrosophila ananassae miR-317 stem-loop
Gene family MIPF0000144; mir-317
Stem-loop
   -    --u    ug     aua    --     c      u aa  a 
5'  ugca   cggc  cuggg   cacc  cugug ucgcuu g  ug a
    ||||   ||||  |||||   ||||  ||||| |||||| |  || a
3'  acgu   gccg  gaccu   gugg  gacac agugaa c  ac u
   u    uuu    gu     aug    uc     a      - ga  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 6479993-6480083 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-317
dan-mir-317scaffold_13340: 6479993-6480083 [+]
dan-mir-277scaffold_13340: 6488996-6489093 [+]
dan-mir-34scaffold_13340: 6489985-6490081 [+]
Database links

Mature sequence dan-miR-317

Accession MIMAT0008452
Sequence

55 - 

ugaacacagcuggugguauccagu

 - 78

Get sequence
Evidence by similarity; MI0000429

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).