Stem-loop sequence dan-mir-281-1

AccessionMI0008987 (change log)
DescriptionDrosophila ananassae miR-281-1 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
         cg  a           -ug     c      ccagau 
5' cgaaua  ug auaaagagagc   uccgu gacagu      a
   ||||||  || |||||||||||   ||||| ||||||      c
3' gcuuau  au uguuucucucg   aggua cuguca      c
         -a  a           uua     -      caauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 2568753-2568838 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-281-1
dan-mir-281-1scaffold_13266: 2568753-2568838 [+]
dan-mir-281-2scaffold_13266: 2568938-2569031 [+]
Database links

Mature sequence dan-miR-281-1-5p

Accession MIMAT0008428
Previous IDsdan-miR-281-1*
Sequence

15 - 

aagagagcuguccgucgacagu

 - 36

Get sequence
Evidence by similarity; MI0000366

Mature sequence dan-miR-281-3p

Accession MIMAT0008429
Previous IDsdan-miR-281
Sequence

54 - 

ugucauggaauugcucucuuugu

 - 76

Get sequence
Evidence by similarity; MI0000366

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).