Stem-loop sequence dan-mir-275

AccessionMI0008985 (change log)
DescriptionDrosophila ananassae miR-275 stem-loop
Gene family MIPF0000187; mir-275
Stem-loop
   -a    c     u         -a    ug   gg     guuu 
5'   gucu cuacc ugcgcgcua  ucag  acc  ggcug    u
     |||| ||||| |||||||||  ||||  |||  |||||     
3'   caga ggugg gcgcgcgau  aguc  ugg  cugac    u
   ua    c     u         ga    ca   -a     aacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12916: 15333995-15334081 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-275
dan-mir-275scaffold_12916: 15333995-15334081 [+]
dan-mir-305scaffold_12916: 15334164-15334236 [+]
Database links

Mature sequence dan-miR-275

Accession MIMAT0008451
Sequence

52 - 

ucagguaccugaaguagcgcgcg

 - 74

Get sequence
Evidence by similarity; MI0000356

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).