Stem-loop sequence dan-mir-274

AccessionMI0008982 (change log)
DescriptionDrosophila ananassae miR-274 stem-loop
Gene family MIPF0000264; mir-274
Stem-loop
   -             --u       c  a  cu        u   acagg 
5'  uguugcaguuucg   uuuguga cg ca  aacgggua uuu     a
    |||||||||||||   ||||||| || ||  |||||||| |||      
3'  acgacguuaaagu   aaacacu gc gu  uugcucau agg     c
   a             ccu       a  -  uu        u   acaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 5918622-5918717 [+]
intergenic
Database links

Mature sequence dan-miR-274

Accession MIMAT0008448
Sequence

14 - 

uuuugugaccgacacuaacggguauu

 - 39

Get sequence
Evidence by similarity; MI0000355

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).