Stem-loop sequence dan-mir-263b

AccessionMI0008981 (change log)
DescriptionDrosophila ananassae miR-263b stem-loop
Gene family MIPF0000122; mir-263
Stem-loop
   -u     -c   g   c        g g     u     -u      
5'   gcugu  uuu aau uuggcacu g agaau cacag  ugauu 
     |||||  ||| ||| |||||||| | ||||| |||||  |||| u
3'   cggua  aaa uua aaccgugg c ucuug guguc  auuau 
   uc     au   g   a        g g     -     uu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 11320743-11320831 [+]
intergenic
Database links

Mature sequence dan-miR-263b

Accession MIMAT0008447
Sequence

15 - 

cuuggcacugggagaauucac

 - 35

Get sequence
Evidence by similarity; MI0000383

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).