Stem-loop sequence dan-mir-276b

AccessionMI0008980 (change log)
DescriptionDrosophila ananassae miR-276b stem-loop
Gene family MIPF0000124; mir-276
Stem-loop
   ac   -     auuug   uc    a     a           ugcc   ua 
5'   cga agccu     cca  agcg gguau gaguuccuacg    acu  a
     ||| |||||     |||  |||| ||||| |||||||||||    |||   
3'   gcu ucggg     ggu  ucgu ccaua uucaaggaugc    uga  a
   ca   g     ----a   uc    g     a           ----   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 15233380-15233476 [+]
intergenic
Database links

Mature sequence dan-miR-276b

Accession MIMAT0008446
Sequence

61 - 

uaggaacuuaauaccgugcucu

 - 82

Get sequence
Evidence by similarity; MI0000375

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).