Stem-loop sequence dan-mir-282

AccessionMI0008979 (change log)
DescriptionDrosophila ananassae miR-282 stem-loop
Gene family MIPF0000150; mir-282
Stem-loop
   uu    -a  g           ac      u      ugcau   a 
5'   ccuu  ua aucuagccucu  uaggcu ugucug     ucg a
     ||||  || |||||||||||  |||||| ||||||     ||| a
3'   ggaa  au uggauuggaga  auccga acagac     agc g
   gc    cc  g           au      u      ----u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 7556610-7556699 [+]
intergenic
Database links

Mature sequence dan-miR-282

Accession MIMAT0008445
Sequence

10 - 

gaucuagccucuacuaggcuuugucugu

 - 37

Get sequence
Evidence by similarity; MI0000367

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).