Stem-loop sequence dan-mir-286

AccessionMI0008978 (change log)
DescriptionDrosophila ananassae miR-286 stem-loop
Gene family MIPF0000225; mir-286
Stem-loop
   --         aaug    u   -    a          uucacaaaaaaa   guu 
5'   uuaaaauug    gcga ugu cggu uggucgcuuu            uug   a
     |||||||||    |||| ||| |||| ||||||||||            |||    
3'   aauuuuaau    ugcu aca gcca aucagugaag            aac   c
   aa         aucg    c   a    g          ----------cg   aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 9731359-9731461 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-286
dan-mir-309scaffold_13266: 9731113-9731180 [+]
dan-mir-3scaffold_13266: 9731226-9731298 [+]
dan-mir-286scaffold_13266: 9731359-9731461 [+]
dan-mir-4scaffold_13266: 9731523-9731603 [+]
dan-mir-5scaffold_13266: 9731682-9731748 [+]
dan-mir-6-1scaffold_13266: 9731820-9731887 [+]
dan-mir-6-2scaffold_13266: 9731963-9732046 [+]
dan-mir-6-3scaffold_13266: 9732122-9732197 [+]
Database links

Mature sequence dan-miR-286

Accession MIMAT0008444
Sequence

69 - 

ugacuagaccgaacacucgugcu

 - 91

Get sequence
Evidence by similarity; MI0000380

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).