Stem-loop sequence dan-mir-263a

AccessionMI0008977 (change log)
DescriptionDrosophila ananassae miR-263a stem-loop
Gene family MIPF0000122; mir-263
Stem-loop
   --      g   a  ua   g     ga   au       guaauu 
5'   aucucg cac gu  aug cacug  aga  ucacggg      u
     |||||| ||| ||  ||| |||||  |||  |||||||      c
3'   uagggc gug ua  uac gugau  ucu  agugccc      u
   au      -   g  uc   g     uc   --       aacaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12943: 2289713-2289802 [+]
intergenic
Database links

Mature sequence dan-miR-263a

Accession MIMAT0008443
Sequence

12 - 

guuaauggcacuggaagaauucac

 - 35

Get sequence
Evidence by similarity; MI0000343

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).