Stem-loop sequence dan-mir-2c

AccessionMI0008976 (change log)
DescriptionDrosophila ananassae miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   au    c  u       -      aag     aa  g       ug 
5'   cuua uu caauguc aucaaa   ggcug  ga auauuuc  c
     |||| || ||||||| ||||||   |||||  || |||||||  a
3'   gaau aa guuacgg uaguuu   ccgac  cu ugugaag  u
   -c    -  c       g      cga     -a  a       uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 12827838-12827928 [-]
intergenic
Clustered miRNAs
< 10kb from dan-mir-2c
dan-mir-2cscaffold_13340: 12827838-12827928 [-]
dan-mir-13ascaffold_13340: 12827627-12827700 [-]
dan-mir-13b-1scaffold_13340: 12827484-12827552 [-]
Database links

Mature sequence dan-miR-2c

Accession MIMAT0008442
Sequence

57 - 

uaucacagccagcuuugaugggc

 - 79

Get sequence
Evidence by similarity; MI0000431

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).