Stem-loop sequence dan-mir-iab-4

AccessionMI0008975 (change log)
DescriptionDrosophila ananassae miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
       -a             u    c   ag  u 
5' ucgu  uacguauacugaa guau cug  ug a
   ||||  ||||||||||||| |||| |||  || u
3' agca  augcauaugacuu caua ggc  au c
       ca             c    u   cu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 7215203-7215270 [-]
intergenic
Database links

Mature sequence dan-miR-iab-4-5p

Accession MIMAT0008440
Sequence

7 - 

acguauacugaauguauccuga

 - 28

Get sequence
Evidence by similarity; MI0000432

Mature sequence dan-miR-iab-4-3p

Accession MIMAT0008441
Sequence

41 - 

cgguauaccuucaguauacguaac

 - 64

Get sequence
Evidence by similarity; MI0000432

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).