Stem-loop sequence dan-mir-34

AccessionMI0008974 (change log)
DescriptionDrosophila ananassae miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   ug   a  -   uu        u  u   c        uagcugg    c 
5'   gcu ug cgc  uggcagug gg uag ugguugug       ugcu g
     ||| || |||  |||||||| || ||| ||||||||       ||||  
3'   cga ac gcg  gccgucac uc auc accgacac       acgg u
   --   -  a   cc        u  u   -        uuaauua    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 6489985-6490081 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-34
dan-mir-317scaffold_13340: 6479993-6480083 [+]
dan-mir-277scaffold_13340: 6488996-6489093 [+]
dan-mir-34scaffold_13340: 6489985-6490081 [+]
Database links

Mature sequence dan-miR-34

Accession MIMAT0008439
Sequence

14 - 

uggcagugugguuagcugguug

 - 35

Get sequence
Evidence by similarity; MI0000371

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).