Stem-loop sequence dan-mir-283

AccessionMI0008972 (change log)
DescriptionDrosophila ananassae miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   cu     uu      aa           u         a --c    cc 
5'   gauuc  aaaggu  auaucagcugg aauucuggg g   uaug  u
     |||||  ||||||  ||||||||||| ||||||||| |   ||||   
3'   uuaag  uuuuca  uaugguugacu uuaaggcuc c   guau  g
   --     cu      gc           -         a aaa    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12929: 2900391-2900485 [-]
intergenic
Clustered miRNAs
< 10kb from dan-mir-283
dan-mir-283scaffold_12929: 2900391-2900485 [-]
dan-mir-304scaffold_12929: 2899110-2899197 [-]
dan-mir-12scaffold_12929: 2898586-2898659 [-]
Database links

Mature sequence dan-miR-283

Accession MIMAT0008437
Sequence

15 - 

uaaauaucagcugguaauucu

 - 35

Get sequence
Evidence by similarity; MI0000368

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).