Stem-loop sequence dan-mir-184

AccessionMI0008971 (change log)
DescriptionDrosophila ananassae miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   cc    c  u  ua         -     g  -  ccg   -g a 
5'   ggug au cg  cccuuauca uucuc cg cc   ugu  c u
     |||| || ||  ||||||||| ||||| || ||   |||  | a
3'   ccac ua gc  gggaauagu aagag gc gg   aca  g a
   aa    -  u  uc         c     -  a  uca   ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 16524586-16524673 [-]
intergenic
Database links

Mature sequence dan-miR-184-5p

Accession MIMAT0008435
Previous IDsdan-miR-184*
Sequence

16 - 

ccuuaucauucucgcgccccg

 - 36

Get sequence
Evidence by similarity; MI0000354

Mature sequence dan-miR-184-3p

Accession MIMAT0008436
Previous IDsdan-miR-184
Sequence

55 - 

uggacggagaacugauaagggc

 - 76

Get sequence
Evidence by similarity; MI0000354

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).