Stem-loop sequence dan-mir-210

Accession MI0008969
Description Drosophila ananassae miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ac   -g     ugc        gc   -         uuaga 
  ggu  cuuau   agcugcug  cac ugcacaaga     c
  |||  |||||   ||||||||  ||| |||||||||     u
  ccg  gaaug   ucggcgac  gug gcguguucu     u
ua   ga     uua        -a   u         cagaa 
Get sequence
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13335: 1604021-1604106 [-]
intergenic

Mature sequence dan-miR-210

Accession MIMAT0008433
Sequence

52 - 

uugugcgugugacagcggcua

 - 72

Get sequence
Evidence by similarity; MI0000376

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).