Stem-loop sequence dan-mir-1

AccessionMI0008968 (change log)
DescriptionDrosophila ananassae miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   -a   uuu  --ga            c        a   -  auaa 
5'   gcc   ga    guuccaugcuuc uugcauuc aua gu    u
     |||   ||    |||||||||||| |||||||| ||| ||     
3'   cgg   cu    cgagguaugaag aauguaag uau cg    a
   aa   --u  aaag            a        g   a  aacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12916: 6985825-6985912 [+]
intergenic
Database links

Mature sequence dan-miR-1

Accession MIMAT0008432
Sequence

54 - 

uggaauguaaagaaguauggag

 - 75

Get sequence
Evidence by similarity; MI0000116

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).