Stem-loop sequence dan-mir-281-2

AccessionMI0008965 (change log)
DescriptionDrosophila ananassae miR-281-2 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
        a  gaa ug        -ua     c      ---ca    aaa 
5' cgaau gu   a  aagagagc   uccgu gacagu     aguu   a
   ||||| ||   |  ||||||||   ||||| ||||||     ||||    
3' gcuua ca   u  uucucucg   aggua cuguca     uuag   c
        -  aua gu        uua     -      uaaug    gca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 2568938-2569031 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-281-2
dan-mir-281-1scaffold_13266: 2568753-2568838 [+]
dan-mir-281-2scaffold_13266: 2568938-2569031 [+]
Database links

Mature sequence dan-miR-281-2-5p

Accession MIMAT0009182
Previous IDsdan-miR-281-2*
Sequence

15 - 

aagagagcuauccgucgacagu

 - 36

Get sequence
Evidence by similarity; MI0000370

Mature sequence dan-miR-281-3p

Accession MIMAT0008429
Previous IDsdan-miR-281
Sequence

62 - 

ugucauggaauugcucucuuugu

 - 84

Get sequence
Evidence by similarity; MI0000366

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).