Stem-loop sequence dan-mir-310

AccessionMI0008962 (change log)
DescriptionDrosophila ananassae miR-310 stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
        aa       c   a    ga c   a        auauu 
5' aacau  acacuug agg cggg  g gug caauauau     u
   |||||  ||||||| ||| ||||  | ||| ||||||||     u
3' uugua  ugugaau ucc gccc  c cac guuauaua     a
        aa       a   g    uc a   -        caaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 4133049-4133138 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-310
dan-mir-311bscaffold_13266: 4132538-4132607 [+]
dan-mir-312scaffold_13266: 4132689-4132745 [+]
dan-mir-311ascaffold_13266: 4132931-4133008 [+]
dan-mir-310scaffold_13266: 4133049-4133138 [+]
Database links

Mature sequence dan-miR-310

Accession MIMAT0008425
Sequence

56 - 

uauugcacaccucccggccuau

 - 77

Get sequence
Evidence by similarity; MI0000422

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).