Stem-loop sequence dan-mir-3

AccessionMI0008960 (change log)
DescriptionDrosophila ananassae miR-3 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
                       g    u   caccaa 
5' gaucuugggacgcauuuugu cagu aug      a
   |||||||||||||||||||| |||| |||      a
3' cuaggacucugugugaaacg guca uac      a
                       g    c   cuauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 9731226-9731298 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-3
dan-mir-309scaffold_13266: 9731113-9731180 [+]
dan-mir-3scaffold_13266: 9731226-9731298 [+]
dan-mir-286scaffold_13266: 9731359-9731461 [+]
dan-mir-4scaffold_13266: 9731523-9731603 [+]
dan-mir-5scaffold_13266: 9731682-9731748 [+]
dan-mir-6-1scaffold_13266: 9731820-9731887 [+]
dan-mir-6-2scaffold_13266: 9731963-9732046 [+]
dan-mir-6-3scaffold_13266: 9732122-9732197 [+]
Database links

Mature sequence dan-miR-3

Accession MIMAT0008423
Sequence

47 - 

ucacugggcaaagugugucuca

 - 68

Get sequence
Evidence by similarity; MI0000121

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).