Stem-loop sequence dan-mir-308

AccessionMI0008958 (change log)
DescriptionDrosophila ananassae miR-308 stem-loop
Gene family MIPF0000171; mir-308
Stem-loop
              u       u    uuu guu 
5' cucgcaguaua uuuugug uuug   g   u
   ||||||||||| ||||||| ||||   |    
3' gagugucauau aggacac aaac   c   g
              u       u    --u aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 5819969-5820030 [+]
intergenic
Database links

Mature sequence dan-miR-308

Accession MIMAT0008421
Sequence

41 - 

aaucacaggauuauacugugag

 - 62

Get sequence
Evidence by similarity; MI0000419

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).