Stem-loop sequence dan-mir-13a

AccessionMI0008957 (change log)
DescriptionDrosophila ananassae miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
       u     c      -        a   uugcca 
5' uacg aacuc ucaaag ggcuguga aug      u
   |||| ||||| |||||| |||||||| |||      u
3' gugc uugag aguuuu ccgacacu uac      a
       u     u      a        a   ucaucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 12827627-12827700 [-]
intergenic
Clustered miRNAs
< 10kb from dan-mir-13a
dan-mir-2cscaffold_13340: 12827838-12827928 [-]
dan-mir-13ascaffold_13340: 12827627-12827700 [-]
dan-mir-13b-1scaffold_13340: 12827484-12827552 [-]
Database links

Mature sequence dan-miR-13a

Accession MIMAT0008420
Sequence

47 - 

uaucacagccauuuugaugagu

 - 68

Get sequence
Evidence by similarity; MI0000133

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).