Stem-loop sequence dan-mir-285

AccessionMI0008956 (change log)
DescriptionDrosophila ananassae miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --  ga       -a     ga    u      a    uaucaag     cc 
5'   uc  aucaaag  acuga  ucga uggugc uaga       gagau  g
     ||  |||||||  |||||  |||| |||||| ||||       |||||   
3'   ag  uaguuuu  ugacu  agcu accacg aucu       cuuua  a
   ca  aa       cg     aa    u      -    ----uaa     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 6191352-6191449 [-]
intergenic
Database links

Mature sequence dan-miR-285

Accession MIMAT0008419
Sequence

64 - 

uagcaccauucgaaaucagugc

 - 85

Get sequence
Evidence by similarity; MI0000377

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).