Stem-loop sequence dan-mir-12

AccessionMI0008955 (change log)
DescriptionDrosophila ananassae miR-12 stem-loop
Gene family MIPF0000181; mir-12
Stem-loop
         ug     u    c          -  gccuu 
5' uacggc  aguau acau agguacuggu gu     u
   ||||||  ||||| |||| |||||||||| ||      
3' gugccg  ucaua ugua uucaugacca ca     a
         ca     c    -          a  accua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12929: 2898586-2898659 [-]
intergenic
Clustered miRNAs
< 10kb from dan-mir-12
dan-mir-283scaffold_12929: 2900391-2900485 [-]
dan-mir-304scaffold_12929: 2899110-2899197 [-]
dan-mir-12scaffold_12929: 2898586-2898659 [-]
Database links

Mature sequence dan-miR-12

Accession MIMAT0008418
Sequence

7 - 

ugaguauuacaucagguacuggu

 - 29

Get sequence
Evidence by similarity; MI0000132

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).