Stem-loop sequence dan-mir-9b

AccessionMI0008953 (change log)
DescriptionDrosophila ananassae miR-9b stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   u   --c        uuc         uuu    g     uguc 
5'  gca   auuauuug   uuuggugau   agcu uaugg    u
    |||   ||||||||   |||||||||   |||| |||||    c
3'  cgu   ugguaaac   aaaccauua   ucga auacc    a
   a   uuu        caa         -uu    g     uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12916: 15864541-15864628 [-]
intergenic
Clustered miRNAs
< 10kb from dan-mir-9b
dan-mir-9cscaffold_12916: 15865474-15865565 [-]
dan-mir-306scaffold_12916: 15864863-15864947 [-]
dan-mir-79scaffold_12916: 15864720-15864810 [-]
dan-mir-9bscaffold_12916: 15864541-15864628 [-]
Database links

Mature sequence dan-miR-9b

Accession MIMAT0008416
Sequence

15 - 

ucuuuggugauuuuagcuguaug

 - 37

Get sequence
Evidence by similarity; MI0000415

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).