Stem-loop sequence dan-mir-284

AccessionMI0008952 (change log)
DescriptionDrosophila ananassae miR-284 stem-loop
Gene family MIPF0000228; mir-284
Stem-loop
   --         c              acuguguagccugugagggcaag 
5'   guugcaguu cuggaauuaaguug                       g
     ||||||||| ||||||||||||||                        
3'   cggcguuaa gaccuuaguucaac                       c
   cc         c              gacugaagacuucgucaagaguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12911: 3308004-3308101 [-]
intergenic
Database links

Mature sequence dan-miR-284

Accession MIMAT0008415
Sequence

64 - 

agaagucagcaacuugauuccagcaauug

 - 92

Get sequence
Evidence by similarity; MI0000369

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).