Stem-loop sequence dan-mir-304

AccessionMI0008950 (change log)
DescriptionDrosophila ananassae miR-304 stem-loop
Gene family MIPF0000308; mir-304
Stem-loop
       ca    a       aau       u     - ga  u  g 
5' gcag  uuga uaaucuc   uuguaaa gugag c  uu ga c
   ||||  |||| |||||||   ||||||| ||||| |  || ||  
3' cguc  agcu guuagag   aacguuu cacuc g  ag uu c
       ag    c       guc       -     a gc  u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12929: 2899110-2899197 [-]
intergenic
Clustered miRNAs
< 10kb from dan-mir-304
dan-mir-283scaffold_12929: 2900391-2900485 [-]
dan-mir-304scaffold_12929: 2899110-2899197 [-]
dan-mir-12scaffold_12929: 2898586-2898659 [-]
Database links

Mature sequence dan-miR-304

Accession MIMAT0008413
Sequence

12 - 

uaaucucaauuuguaaaugugag

 - 34

Get sequence
Evidence by similarity; MI0000411

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).