Stem-loop sequence dan-mir-7

AccessionMI0008947 (change log)
DescriptionDrosophila ananassae miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention dan-mir-7
(1 sentences)

Stem-loop
          u     u       u  u     --       uggu 
5' agugcau ccgua ggaagac ag gauuu  uguuguu    u
   ||||||| ||||| ||||||| || |||||  |||||||    u
3' uuacgug ggcau ucuucug uc cuaaa  acaauaa    a
          c     -       u  c     ua       uggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 4109368-4109453 [-]
intergenic
Database links

Mature sequence dan-miR-7

Accession MIMAT0008410
Sequence

14 - 

uggaagacuagugauuuuguugu

 - 36

Get sequence
Evidence by similarity; MI0000127

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).