Stem-loop sequence dan-bantam

AccessionMI0008946 (change log)
DescriptionDrosophila ananassae bantam stem-loop
Gene family MIPF0000153; bantam
Stem-loop
   au     uac    c          uu      g   -  uu 
5'   uugac   gaaa cgguuuucga  ugguuu acu gu  u
     |||||   |||| ||||||||||  |||||| ||| ||  u
3'   aacug   uuuu gucgaaaguu  acuaga uga ca  u
   --     ---    a          uu      g   a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13337: 6520594-6520674 [-]
intergenic
Database links

Mature sequence dan-bantam

Accession MIMAT0008409
Sequence

52 - 

ugagaucauuuugaaagcugauu

 - 74

Get sequence
Evidence by similarity; MI0000387

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).