Stem-loop sequence dan-mir-277

AccessionMI0008944 (change log)
DescriptionDrosophila ananassae miR-277 stem-loop
Gene family MIPF0000156; mir-277
Stem-loop
   --   a g       gc  -   gu    -            --  gaaac 
5'   uug a guuuugg  ug cgu  cagg agugcauuugca  cu     a
     ||| | |||||||  || |||  |||| ||||||||||||  ||      
3'   aac u caagacc  ac gca  gucu ucacguaaaugu  ga     u
   cu   a g       uu  a   ug    a            uc  agucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 6488996-6489093 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-277
dan-mir-317scaffold_13340: 6479993-6480083 [+]
dan-mir-277scaffold_13340: 6488996-6489093 [+]
dan-mir-34scaffold_13340: 6489985-6490081 [+]
Database links

Mature sequence dan-miR-277

Accession MIMAT0008407
Sequence

59 - 

uaaaugcacuaucugguacgaca

 - 81

Get sequence
Evidence by similarity; MI0000360

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).