Stem-loop sequence hsv1-mir-H6

AccessionMI0008941
DescriptionHerpes Simplex Virus 1 miR-H6 stem-loop
Gene family MIPF0000738; mir-H1
Stem-loop
       -c   a          ca        u   --a  g 
cgggggg  cgg ggguggaagg  ggggggug agg   ug g
|||||||  ||| ||||||||||  |||||||| |||   || u
gcucccc  gcc ccuaccuucc  cccuucac uuc   ac a
       uu   c          ug        c   agg  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H6-5p

Accession MIMAT0015281
Sequence

14 - 

gguggaaggcaggggggugua

 - 34

Get sequence
Evidence experimental; Illumina [3]

Mature sequence hsv1-miR-H6-3p

Accession MIMAT0008404
Previous IDshsv1-miR-H6
Sequence

54 - 

cacuucccguccuuccauccc

 - 74

Get sequence
Evidence experimental; 454 [1], qRT-PCR [1], Illumina [2-3]

References

1
PMID:18596690 "MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs" Umbach JL, Kramer MF, Jurak I, Karnowski HW, Coen DM, Cullen BR Nature. 454:780-783(2008).
2
PMID:19656888 "Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia" Umbach JL, Nagel MA, Cohrs RJ, Gilden DH, Cullen BR J Virol. 83:10677-10683(2009).
3
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).