|
miRBase |
|
Stem-loop sequence hsv1-mir-H5 |
|
| Accession | MI0008940 |
| Description | Herpes Simplex Virus 1 miR-H5 stem-loop |
| Gene family | MIPF0000966; mir-H5 |
| Stem-loop |
ucg cg c - c ugcc gcgcuccc gggggguu gg aucucu accu ag g |||||||| |||||||| || |||||| |||| || cgcggggg ccucccaa cc uagaga ugga uc c --- -a - c c uaac |
Mature sequence hsv1-miR-H5-5p |
|
| Accession | MIMAT0015280 |
| Sequence |
11 - ggggggguucgggcaucucuac - 32 |
| Evidence | experimental; Solexa [3] |
Mature sequence hsv1-miR-H5-3p |
|
| Accession | MIMAT0008403 |
| Previous IDs | hsv1-miR-H5 |
| Sequence |
53 - gucagagauccaaacccuccgg - 74 |
| Evidence | experimental; 454 [1], qRT-PCR [1], Solexa [2-3] |
References |
|
| 1 |
PMID:18596690
"MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs"
Nature. 454:780-783(2008).
|
| 2 |
PMID:19656888
"Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia"
J Virol. 83:10677-10683(2009).
|
| 3 |
PMID:20181707
"Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2"
J Virol. 84:4659-4672(2010).
|