Stem-loop sequence hsv1-mir-H5

Accession MI0008940
Description Herpes Simplex Virus 1 miR-H5 stem-loop
Gene family MIPF0000966; mir-H5
Stem-loop
           ucg        cg  c      -    c  ugcc 
5' gcgcuccc   gggggguu  gg aucucu accu ag    g
   ||||||||   ||||||||  || |||||| |||| ||     
3' cgcggggg   ccucccaa  cc uagaga ugga uc    c
           ---        -a  -      c    c  uaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H5-5p

Accession MIMAT0015280
Sequence

11 - 

ggggggguucgggcaucucuac

 - 32

Get sequence
Evidence experimental; Illumina [3]

Mature sequence hsv1-miR-H5-3p

Accession MIMAT0008403
Previous IDs hsv1-miR-H5
Sequence

53 - 

gucagagauccaaacccuccgg

 - 74

Get sequence
Evidence experimental; 454 [1], qRT-PCR [1], Illumina [2-3]

References

1
PMID:18596690 "MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs" Umbach JL, Kramer MF, Jurak I, Karnowski HW, Coen DM, Cullen BR Nature. 454:780-783(2008).
2
PMID:19656888 "Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia" Umbach JL, Nagel MA, Cohrs RJ, Gilden DH, Cullen BR J Virol. 83:10677-10683(2009).
3
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).