|
miRBase |
|
Stem-loop sequence hsv1-mir-H4 |
|
| Accession | MI0008939 |
| Description | Herpes Simplex Virus 1 miR-H4 stem-loop |
| Stem-loop |
- a u g g a gccgggg uggu gaguu gacaggcaagcau ugc ugc g ||||||| |||| ||||| ||||||||||||| ||| ||| cggcucu aucg cucaa cuguccguucgug aug gcg a g - u - a g |
| Comments |
The mature sequence from the 5' arm of this hairpin was named miR-LAT-ICP34.5 in [2]. |
Mature sequence hsv1-miR-H4-5p |
|
| Accession | MIMAT0008401 |
| Previous IDs | hsv1-miR-H4-5p;hsv1-miR-H4 |
| Sequence |
9 - gguagaguuugacaggcaagca - 30 |
| Evidence | experimental; 454 [1], qRT-PCR [1], Solexa [3-4] |
References |
|
| 1 |
PMID:18596690
"MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs"
Nature. 454:780-783(2008).
|
| 2 |
PMID:18678906
"An acutely and latently expressed herpes simplex virus 2 viral microRNA inhibits expression of ICP34.5, a viral neurovirulence factor"
Proc Natl Acad Sci U S A. 105:10931-10936(2008).
|
| 3 |
PMID:19656888
"Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia"
J Virol. 83:10677-10683(2009).
|
| 4 |
PMID:20181707
"Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2"
J Virol. 84:4659-4672(2010).
|