|
miRBase |
|
Stem-loop sequence hsv1-mir-H3 |
|
| Accession | MI0008938 |
| Description | Herpes Simplex Virus 1 miR-H3 stem-loop |
| Gene family | MIPF0000717; mir-H3 |
| Stem-loop |
gc ug - g u g g ccgcgggcgc ucc accgcg gguucc ag ugg c u |||||||||| ||| |||||| |||||| || ||| | g ggugcccgcg agg uggcgu ucaggg uc auu g g gc gu g - c g a |
| Comments |
This sequence was named miR-I in [2]. |
Mature sequence hsv1-miR-H3-5p |
|
| Accession | MIMAT0015279 |
| Previous IDs | hsv1-miR-H3* |
| Sequence |
12 - cuccugaccgcggguuccgagu - 33 |
| Evidence | experimental; Solexa [4] |
Mature sequence hsv1-miR-H3-3p |
|
| Accession | MIMAT0008400 |
| Previous IDs | hsv1-miR-H3 |
| Sequence |
50 - cugggacugugcgguugggac - 70 |
| Evidence | experimental; 454 [1], qRT-PCR [1], cloned [2], Solexa [3] |
References |
|
| 1 |
PMID:18596690
"MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs"
Nature. 454:780-783(2008).
|
| 2 |
PMID:18678906
"An acutely and latently expressed herpes simplex virus 2 viral microRNA inhibits expression of ICP34.5, a viral neurovirulence factor"
Proc Natl Acad Sci U S A. 105:10931-10936(2008).
|
| 3 |
PMID:19656888
"Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia"
J Virol. 83:10677-10683(2009).
|
| 4 |
PMID:20181707
"Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2"
J Virol. 84:4659-4672(2010).
|