Stem-loop sequence hsv1-mir-H2

Accession MI0008937
Description Herpes Simplex Virus 1 miR-H2 stem-loop
Gene family MIPF0001214; mir-H2
Stem-loop
   a  -       g  -   -   a   acu    ucu 
gcc cc gucgcac cg ccc ggc cag   cugu   u
||| || ||||||| || ||| ||| |||   ||||   g
cgg gg cagcgug gc ggg ccg guc   ggcg   g
   -  u       a  a   a   a   --c    cuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H2-5p

Accession MIMAT0008398
Previous IDs hsv1-miR-H2-5p;hsv1-miR-H2*
Sequence

8 - 

ucgcacgcgcccggcacagacu

 - 29

Get sequence
Evidence experimental; 454 [18596690], qRT-PCR [18596690], Solexa [19656888,20181707]

Mature sequence hsv1-miR-H2-3p

Accession MIMAT0008399
Previous IDs hsv1-miR-H2-3p;hsv1-miR-H2
Sequence

47 - 

ccugagccagggacgagugcgacu

 - 70

Get sequence
Evidence experimental; 454 [18596690], qRT-PCR [18596690], Solexa [19656888,20181707]

References

1
PMID:18596690 "MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs" Umbach JL, Kramer MF, Jurak I, Karnowski HW, Coen DM, Cullen BR Nature. 454:780-783(2008).
2
PMID:19656888 "Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia" Umbach JL, Nagel MA, Cohrs RJ, Gilden DH, Cullen BR J Virol. 83:10677-10683(2009).
3
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).