Stem-loop sequence tca-mir-9b

AccessionMI0008935 (change log)
DescriptionTribolium castaneum miR-9b stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention tca-mir-9b
(3 sentences)

Stem-loop
   uugac  c   aag      ugu    gg      ----  g -  g  -      uu    a               g          u 
5'      ga cgu   uuucuu   uuuu  uuccaa    ca g ug gg gccgau  uguu cuuugguaauuuagc uuugugauuu a
        || |||   ||||||   ||||  ||||||    || | || || ||||||  |||| ||||||||||||||| |||||||||| u
3'      cu gca   gaagaa   aagg  gagguu    gu c gc uu cgguug  guaa gaaaccauuagaucg aaauacugag u
   --uua  u   ---      --u    uu      agag  g u  g  a      gc    c               -          u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped48: 113100-113268 [-]
intergenic
Database links

Mature sequence tca-miR-9b-5p

Accession MIMAT0019134
Sequence

58 - 

cuuugguaauuuagcguuugu

 - 78

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-9b-3p

Accession MIMAT0019135
Sequence

94 - 

auaaagcuagauuaccaaagca

 - 115

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
PMID:18571123 "Genome-wide mapping of conserved microRNAs and their host transcripts in Tribolium castaneum" Luo Q, Zhou Q, Yu X, Lin H, Hu S, Yu J J Genet Genomics. 35:349-355(2008).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).