Stem-loop sequence tca-mir-9b

Accession

MI0008935

Description

Tribolium castaneum miR-9b stem-loop

Gene family

MIPF0000014; mir-9

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Stem-loop

uugac  c   aag      ugu    gg      ----  g -  g  -      uu    a               g          u 
     ga cgu   uuucuu   uuuu  uuccaa    ca g ug gg gccgau  uguu cuuugguaauuuagc uuugugauuu a
     || |||   ||||||   ||||  ||||||    || | || || ||||||  |||| ||||||||||||||| |||||||||| u
     cu gca   gaagaa   aagg  gagguu    gu c gc uu cgguug  guaa gaaaccauuagaucg aaauacugag u
--uua  u   ---      --u    uu      agag  g u  g  a      gc    c               -          u 

Deep sequencing

3316 reads, 2 experiments

Database links

• ENTREZGENE: 100314381;Mir9b

Mature sequence tca-miR-9b-5p

• Accession: MIMAT0019134
• Sequence: 58 - cuuugguaauuuagcguuugu - 78
• Deep sequencing: 228 reads, 2 experiments
• Evidence: experimental; SOLID [2]

Mature sequence tca-miR-9b-3p

• Accession: MIMAT0019135
• Sequence: 94 - auaaagcuagauuaccaaagca - 115
• Deep sequencing: 3078 reads, 2 experiments
• Evidence: experimental; SOLID [2]

References

1. PMID:18571123 "Genome-wide mapping of conserved microRNAs and their host transcripts in Tribolium castaneum" Luo Q, Zhou Q, Yu X, Lin H, Hu S, Yu J J Genet Genomics. 35:349-355(2008).
2. PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).