Stem-loop sequence tca-mir-929

AccessionMI0008934 (change log)
DescriptionTribolium castaneum miR-929 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop
   -   cgg  au     uc        a        ag         c    c 
5'  aga   cc  cuuaa  ggggucaa uugacucu  uagggaguc guua u
    |||   ||  |||||  |||||||| ||||||||  ||||||||| |||| u
3'  ucu   gg  gaguu  ccucaguu gacugagg  aucccucag cgau u
   a   aaa  --     uc        g        ca         -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 8045980-8046082 [-]
intergenic
Database links

Mature sequence tca-miR-929-5p

Accession MIMAT0008395
Previous IDstca-miR-929
Sequence

25 - 

aauugacucuaguagggaguc

 - 45

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-929-3p

Accession MIMAT0019133
Sequence

62 - 

cucccuaacggagucagguug

 - 82

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
PMID:18571123 "Genome-wide mapping of conserved microRNAs and their host transcripts in Tribolium castaneum" Luo Q, Zhou Q, Yu X, Lin H, Hu S, Yu J J Genet Genomics. 35:349-355(2008).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).