Stem-loop sequence tca-mir-iab-4

AccessionMI0008933 (change log)
DescriptionTribolium castaneum miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
   uuaaa  c     -            u    -  u  gu u 
5'      cc ccugu acguauacugaa guau cc ga  g u
        || ||||| |||||||||||| |||| || ||  |  
3'      gg ggaca ugcauaugacuu caua gg cu  c u
   -cacc  a     a            c    u  c  gu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 7614308-7614388 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-iab-4
tca-mir-iab-4ChLG2: 7614308-7614388 [-]
tca-mir-iab-8ChLG2: 7614302-7614395 [+]
Database links

Mature sequence tca-miR-iab-4-5p

Accession MIMAT0008393
Sequence

14 - 

acguauacugaauguauccuga

 - 35

Get sequence
Evidence experimental; SOLID [3]
Database links

Mature sequence tca-miR-iab-4-3p

Accession MIMAT0008394
Sequence

48 - 

cgguauaccuucaguauacguaac

 - 71

Get sequence
Evidence experimental; SOLID [3]
Database links

References

1
PMID:18392875 "Analysis of the Tribolium homeotic complex: insights into mechanisms constraining insect Hox clusters" Shippy TD, Ronshaugen M, Cande J, He J, Beeman RW, Levine M, Brown SJ, Denell RE Dev Genes Evol. 218:127-139(2008).
2
3
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).