Stem-loop sequence tca-mir-932

AccessionMI0008932 (change log)
DescriptionTribolium castaneum miR-932 stem-loop
Gene family MIPF0000588; mir-932
Stem-loop
       u   u       a       g   a      ugu    a 
5' ggag gcg gucuuca uuccgua ugc uugcag   uugu g
   |||| ||| ||||||| ||||||| ||| ||||||   ||||  
3' ucuc ugc uaggagu aaggcgu acg aacguc   gacg c
       -   u       g       g   -      --u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 13611452-13611535 [-]
intergenic
Database links

Mature sequence tca-miR-932-5p

Accession MIMAT0008392
Previous IDstca-miR-932
Sequence

14 - 

ucaauuccguagugcauugcagu

 - 36

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-932-3p

Accession MIMAT0019132
Sequence

53 - 

ugcaagcagugcggaagugag

 - 73

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).