Stem-loop sequence tca-mir-927a

AccessionMI0008931 (change log)
Previous IDstca-mir-927
DescriptionTribolium castaneum miR-927 stem-loop
Gene family MIPF0000452; mir-927
Stem-loop
   u               cu       a   u  g 
5'  uucgguuuagaauuc  acgcuuu ccg gu a
    |||||||||||||||  ||||||| ||| || a
3'  aagcuaagucuuagg  ugcgaaa ggu cg a
   c               uu       c   -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 11531396-11531463 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-927a
tca-mir-927aChLG9: 11531396-11531463 [+]
tca-mir-927cChLG9: 11531399-11531457 [-]
Database links

Mature sequence tca-miR-927a-5p

Accession MIMAT0008391
Previous IDstca-miR-927;tca-miR-927-5p
Sequence

7 - 

uuuagaauuccuacgcuuua

 - 26

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-927a-3p

Accession MIMAT0019131
Previous IDstca-miR-927-3p
Sequence

43 - 

caaagcguuuggauucugaaucg

 - 65

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).