Stem-loop sequence tca-mir-317

AccessionMI0008930 (change log)
DescriptionTribolium castaneum miR-317 stem-loop
Gene family MIPF0000144; mir-317
Literature search

1 open access papers mention tca-mir-317
(2 sentences)

Stem-loop
     c  -u       -      --           cu  au 
5' gg gg  gcugggg accacc  cuguguuuacu  gu  u
   || ||  ||||||| ||||||  |||||||||||  ||   
3' cc uc  ugacucu uggugg  gacacaaguga  ca  u
     u  uu       a      uc           -c  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 13750590-13750666 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-317
tca-mir-317ChLG7: 13750590-13750666 [+]
tca-mir-277ChLG7: 13758830-13758910 [+]
Database links

Mature sequence tca-miR-317-5p

Accession MIMAT0019130
Sequence

9 - 

uggggaccacccuguguu

 - 26

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-317-3p

Accession MIMAT0008390
Previous IDstca-miR-317
Sequence

46 - 

ugaacacagcuggugguaucucagu

 - 70

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).