Stem-loop sequence tca-mir-305

AccessionMI0008928 (change log)
DescriptionTribolium castaneum miR-305 stem-loop
Gene family MIPF0000158; mir-305
Literature search

1 open access papers mention tca-mir-305
(1 sentences)

Stem-loop
         uc  u         u      c  u  uaua 
5' cacaug  ua uguacuuca caggug uc gg    c
   ||||||  || ||||||||| |||||| || ||     
3' guguau  au acgugaggu guccac ag cc    u
         ua  c         u      -  c  uuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 10587469-10587543 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-305
tca-mir-275ChLG9: 10587608-10587678 [-]
tca-mir-305ChLG9: 10587469-10587543 [-]
tca-mir-11628ChLG9: 10582062-10582156 [-]
Database links

Mature sequence tca-miR-305-5p

Accession MIMAT0008388
Previous IDstca-miR-305
Sequence

10 - 

auuguacuucaucaggugcuc

 - 30

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-305-3p

Accession MIMAT0019128
Sequence

46 - 

cgacaccuguuggagugcacua

 - 67

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).