Stem-loop sequence tca-mir-283

AccessionMI0008927 (change log)
DescriptionTribolium castaneum miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
        c     -        c     a       uuga 
5' guugu uguga aauaucag uggua uucuggg    u
   ||||| ||||| |||||||| ||||| |||||||     
3' caaca auacu uuauaguc gcuau aagaccc    g
        a     a        a     -       uaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 19667898-19667973 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-283
tca-mir-283ChLG3: 19667898-19667973 [-]
tca-mir-3477ChLG3: 19663710-19663810 [-]
tca-mir-12ChLG3: 19663493-19663579 [-]
Database links

Mature sequence tca-miR-283-5p

Accession MIMAT0008387
Previous IDstca-miR-283
Sequence

11 - 

aaauaucagcugguaauucug

 - 31

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-283-3p

Accession MIMAT0019127
Sequence

46 - 

cagaauaucgacugauauuauca

 - 68

Get sequence
Evidence experimental; SOLID [2]

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).