Stem-loop sequence tca-mir-282

AccessionMI0008926 (change log)
DescriptionTribolium castaneum miR-282 stem-loop
Gene family MIPF0000150; mir-282
Stem-loop
   ug     g       ucc      u     g  aau 
5'   uagag uagccuc   uaggcu ugucu ug   u
     ||||| |||||||   |||||| ||||| ||    
3'   auuuc aucggag   guccga acaga gc   u
   cg     a       uua      u     -  cgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 9033595-9033667 [+]
intergenic
Database links

Mature sequence tca-miR-282-5p

Accession MIMAT0008386
Previous IDstca-miR-282
Sequence

9 - 

uagccucuccuaggcuuugucu

 - 30

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-282-3p

Accession MIMAT0019126
Sequence

46 - 

acauagccugauugaggcuaa

 - 66

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).