Stem-loop sequence tca-mir-281

AccessionMI0008925 (change log)
DescriptionTribolium castaneum miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

1 open access papers mention tca-mir-281
(1 sentences)

Stem-loop
   ucgaaa           -ua     c      a  u 
5'       augaagagagc   uccgu gacagu ua a
         |||||||||||   ||||| |||||| || a
3'       uauuucucucg   aggua cuguca au u
   ------           uug     -      c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 1524911-1524977 [-]
intergenic
Database links

Mature sequence tca-miR-281-5p

Accession MIMAT0008384
Previous IDstca-miR-281*
Sequence

10 - 

aagagagcuauccgucgacagu

 - 31

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-281-3p

Accession MIMAT0008385
Previous IDstca-miR-281
Sequence

45 - 

ugucauggaguugcucucuuu

 - 65

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).